See More

/* JavaScript object that translates a DNA input sequence into a protein sequence. It uses the "Combination Constructor/Prototype Pattern" as described in the book "Professional JavaScript For Web Developers" by Nicholas Zakas. The code is described in link "http://www.javascript-spreadsheet-programming.com/2012/12/object-oriented-javascript-example.html". The scientific background is given in "http://www.javascript-spreadsheet-programming.com/2012/11/using-github-for-javascript-and-vba.html" USE: Useful if you wish to translate a DNA sequence that contains IUPAC ambiguity codes. To use (Executed by Node.js): Append the three code lines below to the code file and execute from the command line with: node TranslateDna.js var seq = 'CCTKAGATCACTCTTTGGCAACGACCCCTCGTCACAATAAAGATAGGGGGGCAACTAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAATTTGCCAGGAAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAGATACTCATAGAAATCTGTGGACATAAAGCTATAGGTACAGTATTAATAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGCTTGGTTGCACTTTAAATTTT'; var trans = new TranslateDna(seq); console.log(trans.getAminoAcids()); Passes JSLint without error when using the default settings. */ // Constructor function sets instance variables. function TranslateDna(dnaSeq) { 'use strict'; this.dnaSeq = dnaSeq.toUpperCase(); this.UNKNOWN = 'X'; this.translateTable = {'GCT': 'A', 'GCC': 'A', 'GCA': 'A', 'GCG': 'A', 'CGT': 'R', 'CGC': 'R', 'CGA': 'R', 'CGG': 'R', 'AGA': 'R', 'AGG': 'R', 'AAT': 'N', 'AAC': 'N', 'GAT': 'D', 'GAC': 'D', 'TGT': 'C', 'TGC': 'C', 'CAA': 'Q', 'CAG': 'Q', 'GAA': 'E', 'GAG': 'E', 'GGT': 'G', 'GGC': 'G', 'GGA': 'G', 'GGG': 'G', 'CAT': 'H', 'CAC': 'H', 'ATT': 'I', 'ATC': 'I', 'ATA': 'I', 'TTA': 'L', 'TTG': 'L', 'CTT': 'L', 'CTC': 'L', 'CTA': 'L', 'CTG': 'L', 'AAA': 'K', 'AAG': 'K', 'ATG': 'M', 'TTT': 'F', 'TTC': 'F', 'CCT': 'P', 'CCC': 'P', 'CCA': 'P', 'CCG': 'P', 'TCT': 'S', 'TCC': 'S', 'TCA': 'S', 'TCG': 'S', 'AGT': 'S', 'AGC': 'S', 'ACT': 'T', 'ACC': 'T', 'ACA': 'T', 'ACG': 'T', 'TGG': 'W', 'TAT': 'Y', 'TAC': 'Y', 'GTT': 'V', 'GTC': 'V', 'GTA': 'V', 'GTG': 'V', 'TAG': '*', 'TGA': '*', 'TAA': '*'}; this.iupacAmbiCodes = {'A': ['A'], 'C': ['C'], 'G': ['G'], 'T': ['T'], 'U': ['U'], 'M': ['A', 'C'], 'R': ['A', 'G'], 'W': ['A', 'T'], 'S': ['C', 'G'], 'Y': ['C', 'T'], 'K': ['G', 'T'], 'V': ['A', 'C', 'G'], 'H': ['A', 'C', 'T'], 'D': ['A', 'G', 'T'], 'B': ['C', 'G', 'T'], 'X': ['G', 'A', 'T', 'C'], 'N': ['G', 'A', 'T', 'C']}; } TranslateDna.prototype = { constructor: TranslateDna, // Perform lookup to return an amino acid for a given nucleotide triplet. getAminoAcid: function (codon) { 'use strict'; return this.translateTable[codon]; }, // Longest and most complex method. Used to disambiguate mixed triplets. getCodonsFromAmbiguous: function (ambiguousCodon) { 'use strict'; var codons = [], first = this.iupacAmbiCodes[ambiguousCodon.charAt(0)], lenFirst = first.length, second = this.iupacAmbiCodes[ambiguousCodon.charAt(1)], lenSecond = second.length, third = this.iupacAmbiCodes[ambiguousCodon.charAt(2)], lenThird = third.length, nuc1, nuc2, nuc3, codon, i, j, k; for (i = 0; i < lenFirst; i += 1) { nuc1 = first[i]; for (j = 0; j < lenSecond; j += 1) { nuc2 = second[j]; for (k = 0; k < lenThird; k += 1) { nuc3 = third[k]; codon = nuc1 + nuc2 + nuc3; codons.push(codon); } } } return codons; }, // Break the instance DNA sequence string into triplets (codons). Assumes the DNA is in-frame. splitSequenceIntoTriplets: function () { 'use strict'; var i = 0, seqLen = this.dnaSeq.length, triplets = [], triplet; for (i = 0; i < seqLen; i += 3) { triplet = this.dnaSeq.slice(i, 3 + i); triplets.push(triplet); } this.triplets = triplets; }, //Return an array of triplets, if the instance is set, return it, else generate the triplets array and return it. getTriplets: function () { 'use strict'; if (!this.triplets) { this.splitSequenceIntoTriplets(); } return this.triplets; }, getAminoAcids: function () { 'use strict'; var triplets = this.getTriplets(), tripletCount = triplets.length, aminoAcids = [], aminoAcid, mixedTriplets = [], mixedAminoAcids = [], i, j; for (i = 0; i < tripletCount; i += 1) { //Match only triplets composed of the four standard DNA nucleotide bases. if (triplets[i].match(/[ACGT]{3}/)) { aminoAcid = this.translateTable[triplets[i]]; aminoAcids.push(aminoAcid); } else { //Allowable characters in input (four standard nucleotides A,C,G,T and all recognized IUPAC mixture codes). if (triplets[i].match(/[ACGTUMRWSYKVHDBXN]{3}/)) { mixedTriplets = this.getCodonsFromAmbiguous(triplets[i]); for (j = 0; j < mixedTriplets.length; j += 1) { aminoAcid = this.translateTable[mixedTriplets[j]]; if (mixedAminoAcids.indexOf(aminoAcid) === -1) { mixedAminoAcids.push(aminoAcid); } } aminoAcids.push(mixedAminoAcids); } else { aminoAcids.push(this.UNKNOWN); } } } return aminoAcids; } };