Plot logos with python logomaker¶

Description¶

See More

This small notebook shows examples of how to use the python package logomaker to plot different types of logos.

  • 'Logos' are a type of visualization that shows the probability of certain bases at certain positions in a sequence
  • the underlying data is a matrix of aligned DNA or RNA sequences, in fasta format or as a data frame
  • Probability of enrichment or depletion of certain bases is visualized by magnified or shrinked one-letter symbols for each position

Requirements¶

  • need to install logomaker e.g. with pip
  • optionally need biopython for sequence import and transformations
  • can set up virtual environment for local package installs
  • or simply using pip install will install a package in the user's local site library

To install from a python chunk in a jupyter notebook, run:

import sys
!{sys.executable} -m pip install logomaker biopython requests
  • import libraries
In [ ]:
import Bio.SeqIO
import Bio.SeqUtils
from Bio import motifs
from Bio.Seq import Seq
import numpy as np
import pandas as pd
import matplotlib.pyplot as plt
from requests import get
from io import StringIO
import logomaker
import itertools

Data import¶

  • first step is to import the data in fasta format
  • use biopython to parse the fasta file
  • extract the sequences only and convert to list
In [ ]:
path_fasta = ("../data/motif_alignments.fa")
fasta_db = Bio.SeqIO.parse(path_fasta, "fasta")
fasta_db = [str(i.seq) for i in fasta_db]
In [ ]:
fasta_db[0:5]
Out[ ]:
['AGAGAAGGAAAUAUCGAGAAAUGCCACAGGGAACUGUGAAGUGGUUCAAC',
 'GCUUCAUGAUCGUCGGUUGCUCCCCAGCGGUCACCGGCGGUGACACCACC',
 'UGUCCGGAGCAACCCACCACAUGCCAAGUCCCUCCGUCACCUCGCCGCAA',
 'UCGUGGCGAGCGUGAACAUCAAGCCACUCGAGGACAAGAUCCUCGUUCAG',
 'UCGCCAACUUCACCGUGGCGUCGACACCGCGCAUGUUCGACCGCCAGAGC']
  • sequence data can be stored to a matrix of nucleotide (cols) X sequence positions (rows)
  • values can be one of ‘counts’, ‘probability’, ‘weight’, or ‘information’
In [ ]:
logomaker.alignment_to_matrix(fasta_db, to_type="counts")[0:5]
/home/michael/micromamba/envs/jupyter/lib/python3.9/site-packages/logomaker/src/matrix.py:584: FutureWarning: In a future version, `df.iloc[:, i] = newvals` will attempt to set the values inplace instead of always setting a new array. To retain the old behavior, use either `df[df.columns[i]] = newvals` or, if columns are non-unique, `df.isetitem(i, newvals)`
  counts_df.loc[:, c] = tmp_mat.sum(axis=0).T
Out[ ]:
A C G U
pos
0 5.0 9.0 7.0 5.0
1 4.0 13.0 9.0 0.0
2 8.0 6.0 6.0 6.0
3 5.0 6.0 5.0 10.0
4 4.0 9.0 8.0 5.0
In [ ]:
logomaker.alignment_to_matrix(fasta_db, to_type="weight")[0:5]
/home/michael/micromamba/envs/jupyter/lib/python3.9/site-packages/logomaker/src/matrix.py:584: FutureWarning: In a future version, `df.iloc[:, i] = newvals` will attempt to set the values inplace instead of always setting a new array. To retain the old behavior, use either `df[df.columns[i]] = newvals` or, if columns are non-unique, `df.isetitem(i, newvals)`
  counts_df.loc[:, c] = tmp_mat.sum(axis=0).T
Out[ ]:
A C G U
pos
0 -0.321928 0.415037 0.093109 -0.321928
1 -0.584963 0.900464 0.415037 -2.906891
2 0.263034 -0.099536 -0.099536 -0.099536
3 -0.321928 -0.099536 -0.321928 0.552541
4 -0.584963 0.415037 0.263034 -0.321928
  • supply a custom background matrix in order to correct for the GC content of your organism
  • example: Streptococcus pyogenes has GC content 39%, AT content 61%: probability for A and T: 0.305, and for G and C: 0.195
  • compare the following computed weights with the previous without GC correction
In [ ]:
array_bg = [0.305, 0.195, 0.195, 0.305]
logomaker.alignment_to_matrix(
    fasta_db, to_type="weight", background=np.array([0.305, 0.195, 0.195, 0.305])
)[0:5]
/home/michael/micromamba/envs/jupyter/lib/python3.9/site-packages/logomaker/src/matrix.py:584: FutureWarning: In a future version, `df.iloc[:, i] = newvals` will attempt to set the values inplace instead of always setting a new array. To retain the old behavior, use either `df[df.columns[i]] = newvals` or, if columns are non-unique, `df.isetitem(i, newvals)`
  counts_df.loc[:, c] = tmp_mat.sum(axis=0).T
Out[ ]:
A C G U
pos
0 -0.608809 0.773491 0.451563 -0.608809
1 -0.871844 1.258918 0.773491 -3.193772
2 -0.023847 0.258918 0.258918 -0.386417
3 -0.608809 0.258918 0.036526 0.265660
4 -0.871844 0.773491 0.621488 -0.608809

Logo plots¶

  • logo plot depends on the type of input
  • default for centered logos can be weight
  • make a generalized function for plotting
In [ ]:
def plot_logo(data, to_type="weight", background=None,
    ignore="", title="", ylim=[-6, 2],
    colors = "classic", vpad=0, figsize = [10,3]):
    data_logo = logomaker.alignment_to_matrix(
        data, to_type=to_type, background=background,
        characters_to_ignore=ignore
    )
    data_logo.index = data_logo.index + 1
    title = "{0} (n = {1})".format(title, len(data))
    logo = logomaker.Logo(data_logo,
        fade_below=0.33, flip_below = False,
        color_scheme=colors,
        vpad=vpad, figsize = figsize)
    logo.ax.set_ylim(ylim)
    logo.ax.text(0.5, ylim[1] + 0.1, title, fontsize=14)
    logo.ax.set_xticks(np.arange(2, len(data[0]) + 1, 2))
In [ ]:
plot_logo(fasta_db, title="all cleavage sites")
/home/michael/micromamba/envs/jupyter/lib/python3.9/site-packages/logomaker/src/matrix.py:584: FutureWarning: In a future version, `df.iloc[:, i] = newvals` will attempt to set the values inplace instead of always setting a new array. To retain the old behavior, use either `df[df.columns[i]] = newvals` or, if columns are non-unique, `df.isetitem(i, newvals)`
  counts_df.loc[:, c] = tmp_mat.sum(axis=0).T
No description has been provided for this image
In [ ]:
# define custom colors for the four bases
colors = {"A": "#E7298A", "C": "#66A61E", "G": "#E6AB02", "U": "#999999"}
plot_logo(fasta_db, title="all cleavage sites", colors=colors)
/home/michael/micromamba/envs/jupyter/lib/python3.9/site-packages/logomaker/src/matrix.py:584: FutureWarning: In a future version, `df.iloc[:, i] = newvals` will attempt to set the values inplace instead of always setting a new array. To retain the old behavior, use either `df[df.columns[i]] = newvals` or, if columns are non-unique, `df.isetitem(i, newvals)`
  counts_df.loc[:, c] = tmp_mat.sum(axis=0).T
No description has been provided for this image
In [ ]:
# use a custom background array for A, C, G, U
plot_logo(fasta_db, title="all cleavage sites",
    background=np.array([0.305, 0.195, 0.195, 0.305]),
    colors=colors
)
/home/michael/micromamba/envs/jupyter/lib/python3.9/site-packages/logomaker/src/matrix.py:584: FutureWarning: In a future version, `df.iloc[:, i] = newvals` will attempt to set the values inplace instead of always setting a new array. To retain the old behavior, use either `df[df.columns[i]] = newvals` or, if columns are non-unique, `df.isetitem(i, newvals)`
  counts_df.loc[:, c] = tmp_mat.sum(axis=0).T
No description has been provided for this image
In [ ]:
# use probability instead of weight as alternative
plot_logo(fasta_db, title="all cleavage sites", colors=colors,
    to_type="probability", ylim=[0, 1])
/home/michael/micromamba/envs/jupyter/lib/python3.9/site-packages/logomaker/src/matrix.py:584: FutureWarning: In a future version, `df.iloc[:, i] = newvals` will attempt to set the values inplace instead of always setting a new array. To retain the old behavior, use either `df[df.columns[i]] = newvals` or, if columns are non-unique, `df.isetitem(i, newvals)`
  counts_df.loc[:, c] = tmp_mat.sum(axis=0).T
No description has been provided for this image
In [ ]:
# use information instead of weight as alternative
plot_logo(fasta_db, title="all cleavage sites", colors=colors,
    to_type="information", ylim=[0, 1])
/home/michael/micromamba/envs/jupyter/lib/python3.9/site-packages/logomaker/src/matrix.py:584: FutureWarning: In a future version, `df.iloc[:, i] = newvals` will attempt to set the values inplace instead of always setting a new array. To retain the old behavior, use either `df[df.columns[i]] = newvals` or, if columns are non-unique, `df.isetitem(i, newvals)`
  counts_df.loc[:, c] = tmp_mat.sum(axis=0).T
No description has been provided for this image
In [ ]:
# leave more space between letters: vpad parameter between 0 and 1
plot_logo(fasta_db, title="all cleavage sites", colors=colors, vpad = 0.5)
/home/michael/micromamba/envs/jupyter/lib/python3.9/site-packages/logomaker/src/matrix.py:584: FutureWarning: In a future version, `df.iloc[:, i] = newvals` will attempt to set the values inplace instead of always setting a new array. To retain the old behavior, use either `df[df.columns[i]] = newvals` or, if columns are non-unique, `df.isetitem(i, newvals)`
  counts_df.loc[:, c] = tmp_mat.sum(axis=0).T
No description has been provided for this image
In [ ]:
# change size and xport figure
plot_logo(fasta_db, title="all cleavage sites", colors=colors, figsize = [7.0,3.0])
plt.savefig("../output/sequence_logo.svg")
/home/michael/micromamba/envs/jupyter/lib/python3.9/site-packages/logomaker/src/matrix.py:584: FutureWarning: In a future version, `df.iloc[:, i] = newvals` will attempt to set the values inplace instead of always setting a new array. To retain the old behavior, use either `df[df.columns[i]] = newvals` or, if columns are non-unique, `df.isetitem(i, newvals)`
  counts_df.loc[:, c] = tmp_mat.sum(axis=0).T
No description has been provided for this image

Extract sequence probabilities¶

Variant 1¶

  • from the probability matrix, we can extract the consensus sequence (best hit per position)
  • we also want to extract the N next best sequences, for a given window
  • to this end use again probability matrix with background correction
  • compute all possible k-mers (itertools)
In [ ]:
# compute k-mers, for example with length = 5
kmer_length = 5
kmers = [''.join(p) for p in itertools.product(['G', 'A', 'U', 'C'], repeat=kmer_length)]
print("A total of {0} k-mers with length {1} have been computed.".format(len(kmers), kmer_length))

# make data frame with probabilities
df_prob = logomaker.alignment_to_matrix(
    fasta_db, to_type="probability", background=np.array([0.305, 0.195, 0.195, 0.305])
)

# select a window of length 5, here the interesting region with CA motif
df_prob = df_prob.iloc[23:28].reset_index()
A total of 1024 k-mers with length 5 have been computed.
/home/michael/micromamba/envs/jupyter/lib/python3.9/site-packages/logomaker/src/matrix.py:584: FutureWarning: In a future version, `df.iloc[:, i] = newvals` will attempt to set the values inplace instead of always setting a new array. To retain the old behavior, use either `df[df.columns[i]] = newvals` or, if columns are non-unique, `df.isetitem(i, newvals)`
  counts_df.loc[:, c] = tmp_mat.sum(axis=0).T
  • then for each k-mer, fetch proability of respective nt per position
  • sort by sum, or mean of probability to get best average score
  • print top hits
In [ ]:
# extract nucleotide probabilities and make new df
result = {}
for kmer in kmers:
    result[kmer] = [df_prob.at[pos, kmer[pos]] for pos in range(0, len(kmer))]

result = (
    pd.DataFrame(result)
    .melt()
    .groupby(by="variable", as_index=False, sort=False)
    .agg(["sum", "mean", "median"])
    .value
    .sort_values("sum", ascending=False)
)

result["rank"] = result["sum"].rank(ascending=False)

# print top 10 hits
result.head(10)
Out[ ]:
sum mean median rank
variable
CCACG 2.500000 0.500000 0.400000 1.0
ACACG 2.466667 0.493333 0.400000 2.0
CCACC 2.400000 0.480000 0.400000 3.0
CCAGG 2.400000 0.480000 0.366667 4.0
ACAGG 2.366667 0.473333 0.366667 6.0
ACACC 2.366667 0.473333 0.400000 6.0
CCACA 2.366667 0.473333 0.400000 6.0
ACACA 2.333333 0.466667 0.400000 8.0
UCACG 2.300000 0.460000 0.400000 9.5
CCAGC 2.300000 0.460000 0.366667 9.5

Variant 2¶

  • we use the set of fasta sequences from before and turn it into a Bio.motifs class
  • can find consensus, which should be the same as the top hits from logo
  • then we map this object to arbitrary sequences to find best N hits
  • this strategy is more flexible and allows comparison with new sequences, instead of relying on the predefined window
In [ ]:
fasta_dna = [i.replace("U", "T") for i in fasta_db]
motif = motifs.create([Seq(i[23:28]) for i in fasta_dna], alphabet="ACGT")
motif.consensus
Out[ ]:
Seq('CCACG')
  • the degenerate consensus masks ambiguous positions with N
In [ ]:
motif.degenerate_consensus
Out[ ]:
Seq('NCANN')
  • searching for instances : the most frequent use for a motif is to find its instances in a reference sequence
  • for the reference we simply concenate all entries from making the motif to a single sequence
In [ ]:
ref_seq=Seq("".join(fasta_dna))
print(f"Length of reference sequence: {len(ref_seq)}")
ref_seq
Length of reference sequence: 1300
Out[ ]:
Seq('AGAGAAGGAAATATCGAGAAATGCCACAGGGAACTGTGAAGTGGTTCAACGCTT...GTG')
In [ ]:
result2 = pd.DataFrame(columns=(["start", "end", "strand", "seq", "score"]))

for position, score in motif.pssm.search(ref_seq, threshold=4.0):
    result2 = pd.concat(
        [
            result2,
            pd.DataFrame({
                "start": position,
                "end": position + kmer_length,
                "strand": "+" if position > 0 else "-",
                "seq": str(ref_seq[position:position + kmer_length]),
                "score": score,

            }, index = [1]),
        ]
    ).sort_values("score", ascending=False)

result2["rank"] = result2["score"].rank(ascending=False)

# print top 10 hits
result2.head(10)
Out[ ]:
start end strand seq score rank
1 -1149 -1144 - CGTGG 5.163332 3.0
1 -1087 -1082 - CGTGG 5.163332 3.0
1 1093 1098 + CCACG 5.163332 3.0
1 -95 -90 - CGTGG 5.163332 3.0
1 -724 -719 - CGTGG 5.163332 3.0
1 598 603 + ACACG 5.011329 7.5
1 -778 -773 - CGTGT 5.011329 7.5
1 1073 1078 + ACACG 5.011329 7.5
1 -645 -640 - CGTGT 5.011329 7.5
1 623 628 + CCAGG 4.703900 12.5

Session info¶

In [ ]:
!pip freeze
anyio @ file:///home/conda/feedstock_root/build_artifacts/anyio_1688651106312/work/dist
argon2-cffi @ file:///home/conda/feedstock_root/build_artifacts/argon2-cffi_1692818318753/work
argon2-cffi-bindings @ file:///home/conda/feedstock_root/build_artifacts/argon2-cffi-bindings_1649500321618/work
asttokens @ file:///home/conda/feedstock_root/build_artifacts/asttokens_1667325728359/work
attrs @ file:///home/conda/feedstock_root/build_artifacts/attrs_1683424013410/work
backcall @ file:///home/conda/feedstock_root/build_artifacts/backcall_1592338393461/work
backports.functools-lru-cache @ file:///home/conda/feedstock_root/build_artifacts/backports.functools_lru_cache_1618230623929/work
beautifulsoup4 @ file:///home/conda/feedstock_root/build_artifacts/beautifulsoup4_1680888073205/work
biopython==1.79
black==22.10.0
bleach @ file:///home/conda/feedstock_root/build_artifacts/bleach_1696630167146/work
certifi @ file:///home/conda/feedstock_root/build_artifacts/certifi_1700303426725/work/certifi
cffi @ file:///tmp/abs_98z5h56wf8/croots/recipe/cffi_1659598650955/work
chardet==4.0.0
charset-normalizer==3.0.1
click==8.1.3
contourpy==1.0.6
cycler==0.11.0
debugpy @ file:///tmp/build/80754af9/debugpy_1637091799509/work
decorator @ file:///home/conda/feedstock_root/build_artifacts/decorator_1641555617451/work
defusedxml @ file:///home/conda/feedstock_root/build_artifacts/defusedxml_1615232257335/work
entrypoints @ file:///home/conda/feedstock_root/build_artifacts/entrypoints_1643888246732/work
exceptiongroup @ file:///home/conda/feedstock_root/build_artifacts/exceptiongroup_1700579780973/work
executing @ file:///home/conda/feedstock_root/build_artifacts/executing_1667317341051/work
fastjsonschema @ file:///home/conda/feedstock_root/build_artifacts/python-fastjsonschema_1700055509243/work/dist
fonttools==4.38.0
idna @ file:///home/conda/feedstock_root/build_artifacts/idna_1701026962277/work
importlib-metadata==7.0.0
importlib-resources @ file:///home/conda/feedstock_root/build_artifacts/importlib_resources_1699364556997/work
ipykernel @ file:///home/conda/feedstock_root/build_artifacts/ipykernel_1667262163608/work
ipython @ file:///home/conda/feedstock_root/build_artifacts/ipython_1667140637743/work
ipython-genutils==0.2.0
isodate==0.6.1
jedi @ file:///home/conda/feedstock_root/build_artifacts/jedi_1659959867326/work
Jinja2 @ file:///home/conda/feedstock_root/build_artifacts/jinja2_1654302431367/work
jsonschema @ file:///home/conda/feedstock_root/build_artifacts/jsonschema-meta_1700159890288/work
jsonschema-specifications @ file:///home/conda/feedstock_root/build_artifacts/jsonschema-specifications_1701365715051/work
jupyter-client @ file:///home/conda/feedstock_root/build_artifacts/jupyter_client_1633454794268/work
jupyter-server @ file:///croot/jupyter_server_1671707632269/work
jupyter_core @ file:///home/conda/feedstock_root/build_artifacts/jupyter_core_1667424442212/work
jupyterlab_pygments @ file:///home/conda/feedstock_root/build_artifacts/jupyterlab_pygments_1700744013163/work
kiwisolver==1.4.4
logomaker==0.8
MarkupSafe @ file:///opt/conda/conda-bld/markupsafe_1654597864307/work
matplotlib==3.6.2
matplotlib-inline @ file:///home/conda/feedstock_root/build_artifacts/matplotlib-inline_1660814786464/work
mistune @ file:///home/conda/feedstock_root/build_artifacts/mistune_1698947099619/work
mypy-extensions==0.4.3
nbclassic @ file:///home/conda/feedstock_root/build_artifacts/nbclassic_1683202081046/work
nbclient @ file:///home/conda/feedstock_root/build_artifacts/nbclient_1662750566673/work
nbconvert==7.12.0
nbformat @ file:///home/conda/feedstock_root/build_artifacts/nbformat_1690814868471/work
nest-asyncio @ file:///home/conda/feedstock_root/build_artifacts/nest-asyncio_1664684991461/work
notebook @ file:///home/conda/feedstock_root/build_artifacts/notebook_1695225629675/work
notebook_shim @ file:///home/conda/feedstock_root/build_artifacts/notebook-shim_1682360583588/work
numpy==1.23.4
packaging @ file:///home/conda/feedstock_root/build_artifacts/packaging_1637239678211/work
pandas==1.5.1
pandocfilters @ file:///home/conda/feedstock_root/build_artifacts/pandocfilters_1631603243851/work
parso @ file:///home/conda/feedstock_root/build_artifacts/parso_1638334955874/work
pathspec==0.10.2
pexpect @ file:///home/conda/feedstock_root/build_artifacts/pexpect_1667297516076/work
pickleshare @ file:///home/conda/feedstock_root/build_artifacts/pickleshare_1602536217715/work
Pillow==9.3.0
pkgutil_resolve_name @ file:///home/conda/feedstock_root/build_artifacts/pkgutil-resolve-name_1694617248815/work
platformdirs==2.5.4
prometheus-client @ file:///home/conda/feedstock_root/build_artifacts/prometheus_client_1700579315247/work
prompt-toolkit @ file:///home/conda/feedstock_root/build_artifacts/prompt-toolkit_1667565496306/work
psutil @ file:///opt/conda/conda-bld/psutil_1656431268089/work
ptyprocess @ file:///home/conda/feedstock_root/build_artifacts/ptyprocess_1609419310487/work/dist/ptyprocess-0.7.0-py2.py3-none-any.whl
pure-eval @ file:///home/conda/feedstock_root/build_artifacts/pure_eval_1642875951954/work
pycparser @ file:///home/conda/feedstock_root/build_artifacts/pycparser_1636257122734/work
Pygments @ file:///home/conda/feedstock_root/build_artifacts/pygments_1660666458521/work
pyopenproject==0.7.4
pyparsing @ file:///home/conda/feedstock_root/build_artifacts/pyparsing_1652235407899/work
python-dateutil @ file:///home/conda/feedstock_root/build_artifacts/python-dateutil_1626286286081/work
pytz==2022.6
PyYAML==5.3.1
pyzmq==19.0.2
referencing @ file:///home/conda/feedstock_root/build_artifacts/referencing_1701974441252/work
requests==2.25.1
rpds-py @ file:///croot/rpds-py_1698945930462/work
Send2Trash @ file:///home/conda/feedstock_root/build_artifacts/send2trash_1682601222253/work
six @ file:///home/conda/feedstock_root/build_artifacts/six_1620240208055/work
sniffio @ file:///home/conda/feedstock_root/build_artifacts/sniffio_1662051266223/work
soupsieve @ file:///home/conda/feedstock_root/build_artifacts/soupsieve_1693929250441/work
stack-data @ file:///home/conda/feedstock_root/build_artifacts/stack_data_1667334518791/work
terminado @ file:///home/conda/feedstock_root/build_artifacts/terminado_1699810101464/work
tinycss2 @ file:///home/conda/feedstock_root/build_artifacts/tinycss2_1666100256010/work
tomli==2.0.1
tornado @ file:///home/conda/feedstock_root/build_artifacts/tornado_1648827245914/work
traitlets @ file:///home/conda/feedstock_root/build_artifacts/traitlets_1666115969632/work
typing_extensions @ file:///home/conda/feedstock_root/build_artifacts/typing_extensions_1702176139754/work
urllib3==1.26.14
wcwidth @ file:///home/conda/feedstock_root/build_artifacts/wcwidth_1600965781394/work
webencodings @ file:///home/conda/feedstock_root/build_artifacts/webencodings_1694681268211/work
websocket-client @ file:///home/conda/feedstock_root/build_artifacts/websocket-client_1701630677416/work
zipp @ file:///home/conda/feedstock_root/build_artifacts/zipp_1695255097490/work